Role of umbilical cord mesenchymal stromal cells in skin rejuvenation.

Aging is the main cause of many degenerative diseases. The skin is the largest and the most intuitive organ that reflects the aging of the body. Under the interaction of endogenous and exogenous factors, there are cumulative changes in the structure, function, and appearance of the skin, which are characterized by decreased synthesis of collagen and elastin, increased wrinkles, relaxation, pigmentation, and other aging characteristics. skin aging is inevitable, but it can be delayed. The successful isolation of mesenchymal stromal cells (MSC) in 1991 has greatly promoted the progress of cell therapy in human diseases. The International Society for Cellular Therapy (ISCT) points out that the MSC is a kind of pluripotent progenitor cells that have self-renewal ability (limited) in vitro and the potential for mesenchymal cell differentiation. This review mainly introduces the role of perinatal umbilical cord-derived MSC(UC-MSC) in the field of skin rejuvenation. An in-depth and systematic understanding of the mechanism of UC-MSCs against skin aging is of great significance for the early realization of the clinical transformation of UC-MSCs. This paper summarized the characteristics of skin aging and summarized the mechanism of UC-MSCs in skin rejuvenation reported in recent years. In order to provide a reference for further research of UC-MSCs to delay skin aging.

Mesenchymal stem cells reverse thymus aging by reprogramming the DNA methylation of thymic epithelial cells.

Background: A decrease in the number and activity of thymic epithelial cells (TECs) is an important factor in thymic degeneration. Mesenchymal stem cells (MSCs) treating thymic ageing is a promising strategy, but the DNA methylation modification mechanism in TECs remains unclear. Methods: Aged rhesus monkeys were treated with MSCs to establish a thymic senescence model, and hematoxylin-eosin (HE) staining, immunofluorescence staining, and ELISA were performed to observe the structure and function of the thymus. TEC aging model and MSCs co-culture system were established to detect DNA methylation modification and transcriptomic changes, correlation analysis between transcription factor methylation and mRNA expression, and q-PCR, immunofluorescence staining, and Western blot were used to identified key genes. Results: MSCs improved the structure and function of thymus in elderly macaque monkeys; reduced the expression levels of ß-Gal, P16, and P21; and increased the activity of aging TECs. There were 501 genes with increased methylation in the promoter region in the treated group compared with the untreated group, among which 23 genes were involved in the negative regulation of cell growth, proliferation and apoptosis, while 591 genes had decreased methylation, among which 37 genes were associated with promoting cell growth and proliferation and inhibiting apoptosis. Furthermore, 66 genes showed a negative correlation between promoter methylation levels and gene transcription; specifically, PDE5A, DUOX2, LAMP1 and SVIL were downregulated with increased methylation, inhibiting growth and development, while POLR3G, PGF, CHTF18, KRT17, FOXJ1, NGF, DYRK3, LRP8, CDT1, PRELID1, F2R, KNTC1 and TRIM3 were upregulated with decreased methylation, promoting cell growth. Conclusion: MSCs improve the structure and function of aged thymus, which involves the regulation of DNA methylation profiles and a decrease in the methylation level of the transcription factor NGF to specifically upregulate KRT17 and FOXJ1 to promote the proliferation of TECs.

Whole-transcriptome profiling reveals potential biomarkers for the reversal of thymic epithelial cell senescence by umbilical cord mesenchymal stem cells.

BACKGROUND: Reduced numbers and dysfunction of thymic epithelial cells (TECs) are important factors of thymic degeneration. Previous studies have found that umbilical cord mesenchymal stem cells (UCMSCs) reverse the structure and function of the senescent thymus in vivo. However, the transcriptomic regulation mechanism is unclear. METHODS: TECs were cultured with H2O2 for 72 hours to induce senescence. UCMSCs were cocultured with senescent TECs for 48 hours to detect SA-ß-gal, P16 and Ki67. The cocultured TECs were collected for lncRNA, mRNA and miRNA sequencing to establish a competitive endogenous regulatory network (ceRNA). And RT-qPCR, immunofluorescence staining, and western blot were used to identified key genes. RESULTS: Our results showed that H2O2 induced TEC aging and that UCMSCs reversed these changes. Compared with those in aged TECs, 2260 DE mRNAs, 1033 DE lncRNAs and 67 DE miRNAs were differentially expressed, and these changes were reversed by coculturing the cells with UCMSCs. Differential mRNA enrichment analysis of ceRNA regulation revealed that the PI3K-AKT pathway was a significant signaling pathway. UCMSC coculture upregulated VEGFA, which is the upstream factor of the PI3K-AKT signaling pathway, and the expression of the key proteins PI3K and AKT. Thus, the expression of the cell cycle suppressor P27, which is downstream of the PI3K-AKT signaling pathway, was downregulated, while the expression of the cell cycle regulators CDK2 and CCNE was upregulated. CONCLUSION: UCMSC coculture upregulated the expression of VEGFA, activated the PI3K-AKT signaling pathway, increased the expression of CDK2 and CCNE, decreased the expression of P27, and promoted the proliferation of TECs.

An age classification model based on DNA methylation biomarkers of aging in human peripheral blood using random forest and artificial neural network.

Recent epigenetic studies have revealed a strong association between DNA methylation and aging and lifespan, which changes (increases or decreases) with age. Based on these, the construction of age prediction models associated with DNA methylation levels can be used to infer biological ages closer to the functional state of the organism. We downloaded methylation data from the Gene Expression Omnibus (GEO) public database for normal peripheral blood samples from people of different ages. We grouped the samples according to age (18-35 years and >50 years), screened the methylation sites that differed between the two groups, identified 44 differentially methylated sites, and subsequently obtained 11 age-related characteristic methylation sites using the random forest method. Then, we constructed an age classification model with these 11 characteristic methylation sites using an artificial neural network and evaluated its efficacy. The age classification model was constructed by an artificial neural network and its efficacy was evaluated. The model predicted an area under the curve (AUC) of 0.97 in the validation set and accurately distinguished between those aged 18-35 and >50 years. Furthermore, the levels of these 11 characteristic methylation sites also differed significantly between the two sets of samples in the validation set, including six newly identified age-related methylation sites (P<0.001). Finally, we constructed a multifactor regulatory network based on the corresponding genes of age-related methylation sites to reveal the transcriptional and post-transcriptional regulation patterns. As a result of the increasing problem of aging, the age classification model we constructed allows us to accurately distinguish different age groups at the molecular level, which will be more predictive than chronological age for assessing individual aging and future health status.

Efficacy and Mechanism of Highly Active Umbilical Cord Mesenchymal Stem Cells in the Treatment of Osteoporosis in Rats.

Background: Osteoporosis increases bone brittleness and the risk of fracture. Umbilical cord mesenchymal stem cell (UCMSC) treatment is effective, but how to improve the biological activity and clinical efficacy of UCMSCs has not been determined. METHODS: A rat model of osteoporosis was induced with dexamethasone sodium phosphate. Highly active umbilical cord mesenchymal stem cells (HA-UCMSCs) and UCMSCs were isolated, cultured, identified, and infused intravenously once at a dose of 2.29 × 106 cells/kg. In the 4th week of treatment, bone mineral density (BMD) was evaluated via cross-micro-CT, tibial structure was observed via HE staining, osteogenic differentiation of bone marrow mesenchymal stem cells (BMMSCs) was examined via alizarin red staining, and carboxy-terminal cross-linked telopeptide (CTX), nuclear factor-κß ligand (RANKL), procollagen type 1 N-terminal propeptide (PINP) and osteoprotegerin (OPG) levels were investigated via enzyme-linked immunosorbent assays (ELISAs). BMMSCs were treated with 10-6 mol/L dexamethasone and cocultured with HA-UCMSCs and UCMSCs in transwells. The osteogenic and adipogenic differentiation of BMMSCs was subsequently examined through directional induction culture. The protein expression levels of WNT, ß-catenin, RUNX2, IFN-γ and IL-17 in the bone tissue were measured via Western blotting. RESULTS: The BMD in the healthy group was higher than that in the model group. Both UCMSCs and HA-UCMSCs exhibited a fusiform morphology; swirling growth; high expression of CD73, CD90 and CD105; and low expression of CD34 and CD45 and could differentiate into adipocytes, osteoblasts and chondrocytes, while HA-UCMSCs were smaller in size; had a higher nuclear percentage; and higher differentiation efficiency. Compared with those in the model group, the BMD increased, the bone structure improved, the trabecular area, number, and perimeter increased, the osteogenic differentiation of BMMSCs increased, RANKL expression decreased, and PINP expression increased after UCMSC and HA-UCMSC treatment for 4 weeks. Furthermore, the BMD, trabecular area, number and perimeter, calcareous nodule counts, and OPG/RANKL ratio were higher in the HA-UCMSC treatment group than in the UCMSC treatment group. The osteogenic and adipogenic differentiation of dexamethasone-treated BMMSCs was enhanced after the coculture of UCMSCs and HA-UCMSCs, and the HA-UCMSC group exhibited better effects than the UCMSC coculture group. The protein expression of WNT, ß-catenin, and runx2 was upregulated, and IFN-γ and IL-17 expression was downregulated after UCMSC and HA-UCMSC treatment. CONCLUSION: HA-UCMSCs have a stronger therapeutic effect on osteoporosis compared with that of UCMSCs. These effects include an improved bone structure, increased BMD, an increased number and perimeter of trabeculae, and enhanced osteogenic differentiation of BMMSCs via activation of the WNT/ß-catenin pathway and inhibition of inflammation.

Mechanisms of Stem Cells and Their Secreted Exosomes in the Treatment of Autoimmune Diseases.

Stem cells play a therapeutic role in many diseases by virtue of their strong self-renewal and differentiation abilities, especially in the treatment of autoimmune diseases. At present, the mechanism of the stem cell treatment of autoimmune diseases mainly relies on their immune regulation ability, regulating the number and function of auxiliary cells, anti-inflammatory factors and proinflammatory factors in patients to reduce inflammation. On the other hand, the stem cell- derived secretory body has weak immunogenicity and low molecular weight, can target the site of injury, and can extend the length of its active time in the patient after combining it with the composite material. Therefore, the role of secretory bodies in the stem cell treatment of autoimmune diseases is increasingly important.

Sputum Transcriptomics Reveals FCN1+ Macrophage Activation in Mild Eosinophilic Asthma Compared to Non-Asthmatic Eosinophilic Bronchitis.

PURPOSE: Eosinophilic asthma (EA) and non-asthmatic eosinophilic bronchitis (EB) share similar eosinophilic airway inflammation. Unlike EA, EB did not present airway hyperresponsiveness or airflow obstruction. We aimed to compare the mechanism underlying the different manifestations between EA and EB via sputum transcriptomics analysis. METHODS: Induced-sputum cells from newly physician-diagnosed EA, EB patients, and healthy controls (HCs) were collected for RNA sequencing. RESULTS: Bulk RNA sequencing was performed using sputum cells from patients with EA (n = 18), EB (n = 15) and HCs (n = 28). Principal component analysis revealed similar gene expression patterns in EA and EB. The most differentially expressed genes in EB compared with HC were also shared by EA, including IL4, IL5 IL13, CLC, CPA3, and DNASE1L3. However, gene set enrichment analysis showed that the signatures regulating macrophage activation were enriched in EA compared to EB. Sputum cells were profiled using single-cell RNA sequencing. FABP4+ macrophages, SPP1+ macrophages, FCN1+ macrophages, dendritic cells, T cells, B cells, mast cells, and epithelial cells were identified based on gene expression profiling. Analysis of cell-cell communication revealed that interactions between FCN1+ macrophages and other cells were higher in EA than in EB. A wealth of transforming growth factor beta (TGF-ß) and vascular endothelial growth factor (VEGF) interactions between FCN1+ macrophages and other cells have been shown in EA. The gene expression levels of EREG, TGFBI, and VEGFA in FCN1+ macrophages of EA were significantly higher than those of EB. Furthermore, signatures associated with the response to TGF-ß, cellular response to VEGF stimulus and developmental cell growth were enriched in FCN1+ macrophages of EA compared to those of EB. CONCLUSIONS: FCN1+ macrophage activation associated with airway remodeling processes was upregulated in EA compared to that in EB, which may contribute to airway hyperresponsiveness and airflow obstruction.

Cellular and molecular mechanisms of highly active mesenchymal stem cells in the treatment of senescence of rhesus monkey ovary.

BACKGROUND: Recent studies have shown that umbilical cord mesenchymal stem cells have an anti-aging effect in ovaries, but the cellular and molecular mechanisms of HA-MSC ovarian anti-aging remain to be studied. Therefore, we conducted a 10X Genomics single-nucleus transcriptome sequencing experiment on the ovaries of macaque monkeys after HA-MSC treatment. METHODS: The results of cell subgroup classification were visualized by 10X Genomics single nuclear transcriptome sequencing. The aging model of hGCs was established, and the migration ability of the cells was determined after coculture of HA-MSCs and aging hGCs. The genes screened by single nuclear transcriptional sequencing were verified in vitro by qPCR. RESULTS: Compared with the aging model group, the number of cell receptor pairs in each subgroup of the HA-MSC-treated group increased overall. Treatment with 200 µmol/L H2O2 for 48 h was used as the optimum condition for the induction of hGC senescence. After coculture of noncontact HA-MSCs with senescent hGCs, it was found that HA-MSCs can reverse the cell structure, proliferation ability, senescence condition, expression level of senescence-related genes, and expression level of key genes regulating the senescence pathway in normal hGCs. CONCLUSIONS: HA-MSC therapy can improve the tissue structure and secretion function of the ovary through multiple cellular and molecular mechanisms to resist ovarian aging. In vitro validation experiments further supported the results of single-cell sequencing, which provides evidence supporting a new option for stem cell treatment of ovarian senescence.

IGH repertoire analysis at scale: deciphering the complexity of B cell infiltration and migration in esophageal squamous cell carcinoma.

Tumor-infiltrating B-lineage cells have become predictors of prognosis and immunotherapy responses in various cancers. However, limited knowledge about their infiltration and migration patterns has hindered the understanding of their anti-tumor functions. Here, we examined the immunoglobulin heavy chain (IGH) repertoires in 496 multi-regional tumor, 107 normal tissue, and 48 metastatic lymph node samples obtained from 107 patients with esophageal squamous cell carcinoma (ESCC). Our study revealed higher IgG-type B-lineage cells infiltration in tumors than in healthy tissue, which was associated with improved patient outcomes. Genes such as ACTN1, COL6A5, and pathways like focal adhesion, which shapes the physical structure of tumors, could affect B-lineage cell infiltration. Notably, the IGH sequence was used as an identity-tag to monitor B cell migration, and their infiltration schema within the tumor were depicted based on our multi-regional tumor specimens. This analysis revealed an escalation in B cell clones overlapped between metastatic lymph nodes and tumors. Therefore, the Lymph Node Activation Index was defined, which could predict the outcomes of patients with lymph node metastasis. This research introduces a novel framework for probing B cell infiltration and migration within the tumor microenvironment using large-scale transcriptome data, while simultaneously providing fresh perspectives on B cell immunology within ESCC.

Application and challenges of stem cells in cardiovascular aging.

With the rapid development of society and the economy, population aging has become a common challenge faced by many countries in the world today. Structural and functional changes in the cardiovascular system can occur with age, increasing the incidence and severity of cardiovascular diseases in older adults. Due to the limited regenerative capacity of myocardial cells, myocardial infarction and its resulting heart failure and congenital heart disease have become the number one killer of human health. At present, the treatment of cardiovascular diseases includes drug therapy and nondrug therapy. Nondrug therapy mainly includes minimally invasive interventional therapy, surgical diagnosis and treatment, and cell therapy. Long-term drug treatment may cause headache due to vasodilation, lower blood pressure, digestive system dysfunction and other side effects. Surgical treatment is traumatic, difficult to treat, and expensive. In recent years, stem cell therapy has exhibited broad application prospects in basic and clinical research on cardiovascular disease because of its plasticity, self-renewal and multidirectional differentiation potential. Therefore, this paper looks at stem cell therapy for diseases, reviews recent advances in the mechanism and clinical transformation of cardiovascular aging and related diseases in China, and briefly discusses the development trend and future prospects of cardiovascular aging research.

The Role of T Cells in Alzheimer's Disease Pathogenesis.

Alzheimer's disease (AD) is a progressive neurodegenerative disorder associated with memory decline and cognitive impairment, which is related to hallmark protein aggregates, amyloid-ß (Аß) plaques and neurofibrillary tangles; the latter are accumulated with hyperphosphorylated Tau protein. Immune cells play an important role in AD pathogenesis. Although the role of T cells in AD remains controversial, studies have shown that T cell deficiency is associated with increased AD pathology. In contrast, transplantation of T cells reduces AD pathology. T cells can help B cells generate anti-Ðß antibody to neutralize the toxin of Ðß and hyperphosphorylated Tau. T cells also activate macrophages to phagocytose misfolded proteins including Ðß and Tau. Recent data have also shown that AD animals have a damaged thymic microenvironment, especially thymic epithelial cells (TECs), resulting in decreased T cell numbers, which contribute to AD pathology. Therefore, regulation of T cell regeneration, for example by rejuvenating the thymic microenvironment, has the potential to be used in the treatment of AD.

Shortcut barcoding and early pooling for scalable multiplex single-cell reduced-representation CpG methylation sequencing at single nucleotide resolution.

DNA methylation is essential for a wide variety of biological processes, yet the development of a highly efficient and robust technology remains a challenge for routine single-cell analysis. We developed a multiplex scalable single-cell reduced representation bisulfite sequencing (msRRBS) technology. It allows cell-specific barcoded DNA fragments of individual cells to be pooled before bisulfite conversion, free of enzymatic modification or physical capture of the DNA ends, and achieves read mapping rates of 62.5 ± 3.9%, covering 60.0 ± 1.4% of CpG islands and 71.6 ± 1.6% of promoters in K562 cells. Its reproducibility is shown in duplicates of bulk cells with close to perfect correlation (R = 0.97-0.99). At a low 1 Mb of clean reads, msRRBS provides highly consistent coverage of CpG islands and promoters, outperforming the conventional methods with orders of magnitude reduction in cost. Here, we use this method to characterize the distinct methylation patterns and cellular heterogeneity of six cell lines, plus leukemia and hepatocellular carcinoma models. Taking 4 h of hands-on time, msRRBS offers a unique, highly efficient approach for dissecting methylation heterogeneity in a variety of multicellular systems.

Hematopoietic aging: cellular, molecular, and related mechanisms.

ABSTRACT: Aging is accompanied by significant inhibition of hematopoietic and immune system function and disruption of bone marrow structure. Aging-related alterations in the inflammatory response, immunity, and stem cell niches are at the root of hematopoietic aging. Understanding the molecular mechanisms underlying hematopoietic and bone marrow aging can aid the clinical treatment of aging-related diseases. In particular, it is unknown how the niche reprograms hematopoietic stem cells (HSCs) in an age-dependent manner to maintain normal hematopoiesis in elderly individuals. Recently, specific inhibitors and blood exchange methods have been shown to reshape the hematopoietic niche and reverse hematopoietic aging. Here, we present the latest scientific discoveries related to hematopoietic aging and hematopoietic system rejuvenation, discuss the relationships between hematopoietic niche aging and HSC aging, and describe related studies on stem cell-mediated regulation of hematopoietic aging, aiming to provide new ideas for further study.

A CCL2+DPP4+ subset of mesenchymal stem cells expedites aberrant formation of creeping fat in humans.

Creeping fat is a typical feature of Crohn's disease. It refers to the expansion of mesenteric adipose tissue around inflamed and fibrotic intestines and is associated with stricture formation and intestinal obstruction. In this study, we characterize creeping fat as pro-adipogenic and pro-fibrotic. Lipidomics analysis of Crohn's disease patients (sixteen males, six females) and healthy controls (five males, ten females) reveals abnormal lipid metabolism in creeping fat. Through scRNA-seq analysis on mesenteric adipose tissue from patients (five males, one female) and healthy controls (two females), we identify a CCL2+DPP4+ subset of mesenchymal stem cells that expands in creeping fat and expedites adipogenic differentiation into dystrophic adipocytes in response to CCL20+CD14+ monocytes and IL-6, leading to the formation of creeping fat. Ex vivo experiments (tissues from five males, one female) confirm that both CCL20+CD14+ monocytes and IL-6 activate DPP4+ mesenchymal stem cells towards a pro-adipogenic phenotype. This study provides a comprehensive investigation of creeping fat formation and offers a conceptual framework for discovering therapeutic targets for treatment of Crohn's disease.

Regulatory role of Chitinase 3-like 1 gene in papillary thyroid carcinoma proved by integration analyses of single-cell sequencing with cohort and experimental validations.

Papillary thyroid carcinoma (PTC) is one of the most common thyroid carcinomas. The gross extrathyroidal extension and extensive metastases of PTC lead to high rates of recurrence and poor clinical outcomes. However, the mechanisms underlying PTC development are poorly understood. In this study, using single-cell RNA sequencing, the transcriptome profiles of two PTC patients were addressed, including PTC1 with low malignancy and good prognosis and PTC2 with high malignancy and poor prognosis. We found that epithelial subcluster Epi02 was the most associated with the malignant development of PTC cells, with which the fold change of Chitinase 3-like 1 (CHI3L1) is on the top of the differentially expressed genes between PTC1 and PTC2 (P < 0.001). However CHI3L1 is rarely investigated in PTC as far. We then studied its role in PTC with a series of experiments. Firstly, qRT-PCR analysis of 14 PTC patients showed that the expression of CHI3L1 was positively correlated with malignancy. In addition, overexpression or silencing of CHI3L1 in TPC-1 cells, a PTC cell line, cultured in vitro showed that the proliferation, invasion, and metastasis of the cells were promoted or alleviated by CHI3L1. Further, immunohistochemistry analysis of 110 PTC cases revealed a significant relationship between CHI3L1 protein expression and PTC progression, especially the T (P < 0.001), N (P < 0.001), M stages (P = 0.007) and gross ETE (P < 0.001). Together, our results prove that CHI3L1 is a positive regulator of malignant development of PTC, and it promotes proliferation, invasion, and metastasis of PTC cells. Our study improves understanding of the molecular mechanisms underlying the progression of PTC and provides new insights for the clinical diagnosis and treatment of PTC.

CDK4/6 inhibition triggers ICAM1-driven immune response and sensitizes LKB1 mutant lung cancer to immunotherapy.

Liver kinase B1 (LKB1) mutation is prevalent and a driver of resistance to immune checkpoint blockade (ICB) therapy for lung adenocarcinoma. Here leveraging single cell RNA sequencing data, we demonstrate that trafficking and adhesion process of activated T cells are defected in genetically engineered Kras-driven mouse model with Lkb1 conditional knockout. LKB1 mutant cancer cells result in marked suppression of intercellular adhesion molecule-1 (ICAM1). Ectopic expression of Icam1 in Lkb1-deficient tumor increases homing and activation of adoptively transferred SIINFEKL-specific CD8+ T cells, reactivates tumor-effector cell interactions and re-sensitises tumors to ICB. Further discovery proves that CDK4/6 inhibitors upregulate ICAM1 transcription by inhibiting phosphorylation of retinoblastoma protein RB in LKB1 deficient cancer cells. Finally, a tailored combination strategy using CDK4/6 inhibitors and anti-PD-1 antibodies promotes ICAM1-triggered immune response in multiple Lkb1-deficient murine models. Our findings renovate that ICAM1 on tumor cells orchestrates anti-tumor immune response, especially for adaptive immunity.

Bone Marrow Mesenchymal Stem Cells Reversed Ovarian Aging-related m6A RNA Methylation Modification Profile in Aged Granulosa Cells.

BACKGROUND: Ovarian ageing causes endocrine disturbances and the degeneration of systemic tissue and organ functions to seriously affect women's physical and mental health, and effective treatment methods are urgently needed. Based on our previous studies using juvenile rhesus monkey bone marrow mesenchymal stem cells (BMMSCs) to treat ovarian ageing in rhesus monkey, we found that BMMSCs improved ovarian structure and function. This study continues to explore the mechanism by which BMMSCs reversed granulosa cell (GC) ageing. METHODS: A GC ageing model and coculture system of BMMSCs were established, changes in the level of the N6-methyladenosine (m6A) methylation modification were detected, m6A-modified RNA immunoprecipitation sequencing (MeRIP-seq) were performed, correlations between m6A peaks and mRNA expression were determined, and the expression of hub genes was identified using Q-PCR, immunofluorescence staining, and western blot. RESULTS: Our results showed that H2O2 successfully induced GC ageing and that BMMSCs reversed measures of GC ageing. BMMSCs increased the expression of the FTO protein and reduced the overall level of m6A. We identified 797 m6A peaks (348 hypomethylated and 449 hypermethylated peaks) and 817 differentially expressed genes (DEGs) (412 upregulated and 405 downregulated) after aged GCs were cocultured with BMMSCs, which significantly associated with ovarian function and epigenetic modification. The epigenetic repressive mark and important cell cycle regulator lysine demethylase 8 (KDM8) was downregulated at both the mRNA and protein levels, histone H3 was upregulated in aged GCs after BMMSC coculture, and KDM8 was upregulated after FTO was inhibited through FB23. CONCLUSIONS: Our study revealed an essential role for m6A in BMMSCs in reversing GC ageing, and FTO regulated KDM8 mediates histone H3 changes may as a novel regulatory mechanism in BMMSCs to reverse GC ageing.

Increased Expression of Pluripotent Factors in Human Umbilical Cord Mesenchymal Stem Cells Transfected with Three tRF Molecules.

tRFs and tiRNAs are small noncoding RNA molecules that are widespread in eukaryotic and prokaryotic transcriptomes with extremely powerful functions. We screened three tRF molecules whose expression was stably elevated in reprogrammed cells by tRF and tiRNA sequencing, synthesized these three molecules and transfected them into human umbilical cord mesenchymal stem cells. We detected the pluripotent factor OCT4 by Western Blot (WB) after transfection. The gene and protein expression of the pluripotent genes OCT4 and NANOG increased significantly, and telomere (TEL) expression increased significantly. Cell activity was increased, apoptosis was decreased, and the cell cycle had also changed to some extent. These results showed that the three tRF molecules, tRF-16-K87965D (sequence: CCCGGGTTTCGGCACC), tRF-17-K879652 (sequence: CCCGGGTTTCGGCACCA), and tRF-22-WD8YQ84V2 (sequence: TCGACTCCTGGCTGGCTCGCCA), can promote cell rejuvenation and increase pluripotency.

Advances in Stem Cell Therapy for Intestinal Diseases: Mechanisms, Perspectives Regarding Clinical Applications, and Challenges.

BACKGROUND: Intestinal disease is a common disease, which can cause serious digestion and absorption disorders, endanger the lives of patients and seriously affect the quality of life of people. Finding an effective treatment is a difficult problem at present, and stem cell therapy as a treatment has high application potential in intestinal-related diseases. PURPOSE: This paper mainly summarizes the mechanism, research progress and future development trend of stem cells in the treatment of intestinal diseases in the past decade, hoping to provide a reference for future researchers in the research and application of stem cells and intestinal diseases. METHODS: Stem cells, inflammatory bowel diseases, Crohn's disease, radiation-induced intestinal injury, radiation enterocolitis, and extracellular vesicles were used as search terms. Relevant references in the past ten years were searched in CNKI journal full-text database, PubMed database, VIP network and Wanfang medical network, and 80 literature studies meeting the requirements were finally included for review. RESULTS: This paper summarizes the research and application of stem cells in intestinal diseases from 2012 to 2021, and expounds on the specific mechanism of stem cells in the treatment of intestinal diseases. It has been found that stem cells can treat intestinal injury or inflammation in different ways. CONCLUSION: Future stem cells may also be used to reverse the natural aging of intestinal function, improve intestinal function, and strengthen gastrointestinal function.